Clinical Research Directory

Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer. The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows: Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s. Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.